sea anemone segmentationsea anemone segmentation

PubMed Central Each dish was fed Artemia nauplii two to three times per week. Commun. Note the ciliated groove called a siphonoglyph on the right hand side of the pharynx. Zenkert, C., Takahashi, T., Diesner, M. O. Stay connected with our beautiful campus and the faculty and friends who made your "La Crosse Experience" so special. & Gibson, M. C. Mechanisms of tentacle morphogenesis in the sea anemone Nematostella vectensis. Genikhovich, G. & Technau, U. Bull. Size: Diameter: 0.5 inches to 6 feet. Development 144, 29512960 (2017). Genikhovich, G. & Technau, U. & Martindale, M. Q. Germ layer-specific regulation of cell polarity and adhesion gives insight into the evolution of mesoderm. An experimental framework for early-diverging metazoans. Tentacle progression is indicated on the top of each graph (n=98, 137, and 85 polyps in three independently growing groups). Confirming the TOR dependence of RPS6 phosphorylation, fed animals exposed to rapamycin exhibited a dramatic reduction of pRPS6 and failed to phosphorylate RPS6 at presumptive tentacle primordia (Fig. USA 107, 104108 (2010). Ryan, J. F. et al. 4,10). Data are meanSD for error bars (unpaired Students two-tailed t-test, ****p<0.0001, ns nonsignificant, p=0.8699). Passamaneck, Y. J. The cilia in this groove conduct water currents into the sea anemone. Science 276, 955960 (1997). Polyps with 8-tentacles and two buds (8T+2B, n=37), 10-tentacles (10T, n=107), 10-tentacles with two buds (10T+2B, n=42), and 12-tentacles (12T, n=223). Scale bars are 100m. Two body types are seen in cnidarians; the polyp is a sessile, cylindrical form in which the oral end (mouth and tentacles) is directed upward and the aboral end is attached to the substrate. Oil Red O staining was performed using an established protocol50. Bud-localized proliferation transformed the thin epithelial layers into a thickened outgrowth, generating the initial cellular organization associated with budding stages (Supplementary Fig. "Sea anemones show us that it is possible that nutrients are not converted into excess fat storage - as it is the case in all mammals - but instead transformed into a new body structure,". Amplification primers were: Fgfrb_fwd 5-AAACGCGAAAAGACCCTGATAGC-3 and Fgfrb_rev 5-GGACAGCGGGGACGTCAG-3 antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche). Int. In the current study, we generated a stable mutant line for Fgfrb. However, our results also suggest that distinct upstream inputs co-regulate cell proliferation and the phosphorylation of RPS6. a, b Oral views of fed polyps progressing from 12 to 16 tentacles. The sea anemone is a sessile marine predator of the order Actiniaria. They are named after a terrestrial flower due to their radially symmetric appearance and many tentacles. How do environmental factors influence life cycles and development? Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Upon feeding, reduced-sized polyps developed tentacle buds at smaller oral circumferences compared to full-sized animals, indicating that the feeding-dependent tentacle development relies on a mechanism that scales in proportion to body size (Fig. 5a). The systematic relationship among sea anemones in our study was consistent with previous research (Rodrguez et al., 2014). 4e, f). The formation of tentacles involves coordination between both embryonic body layers. Primary polyps were relaxed in 7% MgCl2 solution for 5min before fixation in 0.25% glutaraldehyde/4% PFA/seawater for 12min at 4C, followed by 4% PFA for 1h at 4C. PubMed Two gRNAs targeting the first and second coding exons were generated via PCR reaction and purified using QIAquick PCR Purification Kit (QIAGEN). Scale bars are 100m. & Ozbek, S. Morphological and molecular analysis of the Nematostella vectensis cnidom. PubMed Central Class Calcarea - Leucosolenia (an ascon sponge), Grantia (a sycon sponge). d Quantification of budding sequence in growing polyps. 1c). Answer Verified 312.6k + views Hint: Sea anemone is a cnidarian and sessile in nature i.e. Biol. Source data are provided as a Source data file. f Confocal projection of the oral pole of fed controls and fed rapamycin-treated polyps stained with Hoechst (white) and labeled for Fgfrb mRNA (purple). Similar to TOR pathway activity, Fgfrb expression showed a segment-dependent regulation in response to feeding (Supplementary Fig. 7, 11694 (2016). This strategy allows cnidarians, like plants, to continuously adjust their developmental patterns to unpredictable fluctuations of food supply2,7. 1b and Supplementary Fig. UWL pride stays strong long after graduation! Using a combination of genetic, cellular and molecular approaches, we demonstrate that the crosstalk between Target of Rapamycin (TOR) and Fibroblast growth factor receptor b (Fgfrb) signaling in ring muscles defines tentacle primordia in fed polyps. Habitat Actinia equina is a considerably versatile intertidal sea anemone. Interestingly, pRPS6-positive cells also adopted a similar organization surrounding the pre-feeding Fgfrb-positive cells (Fig. Cold Spring Harb. & Martindale, M. Q. To probe the relationship between body size and tentacle budding, we generated reduced-sized primary polyps by dividing four-cell stage embryos into two pairs of blastomeres and then allowing development to proceed (Fig. 10)40. 6c and Supplementary Fig. This difference suggests that there are distinct morphogenetic trajectories leading to embryonic and nutrient-dependent postembryonic tentacle development. Still, how new morphological patterns are generated and how developmental patterning unfolds across distinct life history stages remain unknown. Symbiosis 78, 6164 (2019). White arrowheads indicate nuclear localization of Fgfrb mRNA in the eGFP-positive cells. While this octo-radial body plan is maintained in adults32, we found that the spatial pattern of tentacle addition generated three new features in mature polyps with 16-tentacles (Fig. Google Scholar. We are proud to work with our many partners in La Crosse, giving back every day to a community that generously supports our teaching, learning and service mission. If material is not included in the articles Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. Collectively, these variants represented ~20.6% of all specimens scored, perhaps attributable to genetic variation, variation in nutrient uptake, and developmental plasticity in growing polyps. This small, sessile individual has a mouth surrounded with tentacles that are used to procure food. Summary: Evolutionary and developmental biologists have discovered that sea anemones display . Introduction to the Sponges The Phylum Porifera ("pore bearers") contains approximately 5,000 species of animals called sponges. Based on the results described above, we hypothesized that TOR-dependent organismal growth modulates the activity of developmental signaling pathways, which in turn generates a feedback loop that locally enhances TOR pathway activity and promotes polarized growth in tentacle primordia. This is in turn followed by the formation of localized growth zones that mark the sites of the nascent buds. Examples: Aurelia (jelly fish), Physalia (Portuguese man-of-war), Adamsia (Sea anemone), Pennatula (Sea-pen . Biol. Lower panel: unfed reduced-sized polyp resulting from blastomere isolation. Source data are available in the Source data file for Figs. However, as the animals grow, this morphological feature became less pronounced in adults bearing >12 tentacles. Zoologists in the early 1900s described tentacle patterns in select species, some of that could exceed 700 tentacles (e.g., Cereus pedunculatus)10. d Polyps with 9-tentacles (9T, n=29) and 11-tentacles (11T, n=69). We examined 1102 fixed specimens collected between the 4- and 16-tentacle stages, and recorded the placement and order of tentacle formation (Figs. Salinas-Saavedra, M., Rock, A. Q. In situ hybridization of starlet sea anemone (Nematostella vectensis) embryos, larvae, and polyps. 3, 5, 11 and 12. Browse the A-Z index. Injected oocytes were then fertilized and raised at room temperature. Budding stages from 0 to 3 are indicated (see Supplementary Fig. Article Nature 515, 112115 (2014). Technau, U. The phylum Cnidaria includes other jellyfish, corals, and sea anemones, all of which are radially symmetrical. cDNA of Fgfrb was cloned from total RNA isolated from mixed stages of animals using the RNeasy Mini Kit (Qiagen). 7b and Supplementary Fig. The Class Hydrozoa includes a diverse array of cnidarians. Article This work was supported by the Stowers Institute for Medical Research and European Molecular Biology Laboratory. 11), suggesting that this phenotype might be the result of disrupting Fgfrb function during embryoniclarval development. 2ac). and M.A. Article In Mechanisms of Life History Evolution: The Genetics and Physiology of Life History Traits and Trade-Offs (eds. The ability to continuously build new body parts is comparable to regeneration, as both require activation of patterning mechanisms in a differentiated body plan. M.C.G. Since they are rarely more than a few millimeters long, hydras are best studied with a microscope. Along the directive axis, the primary polyp displays mesenteries, internal anatomical structures that subdivide the body into eight recognizable radial segments (s1s8; Fig. Further information on research design is available in theNature Research Reporting Summary linked to this article. PubMed Central While sponges lack any real organs or true tissues, they do contain different types of cells including: epithelial-like cells called pinacocytes that cover the exterior and non-flagellated interior surfaces, flagellated cells called choanocytes that line inner chambers and canals, and amoeboid cells called archeocytes that move about in the mesohyl and can differentiate into other types of cells that form parts of the skeleton (composed of collagen and/or spongin fibers often embedded with calcareous or siliceous crystalline spicules). Thomas, F. and Andreas, H.) Ch. In all experiments, the expression of eGFP was visualized using immunostaining with anti-eGFP antibody (mouse, ThermoFisher, A-11120). Cas9-mediated excision of Nematostella brachyury disrupts endoderm development, pharynx formation and oral-aboral patterning. Meyer, E. J., Ikmi, A. PubMed Any movement is extremely slow, and requires a time-lapse camera to view. Biol. It is well established that sea anemones, corals, and their jellyfish relatives shared a common ancestor with humans that plied the Earth's ancient oceans over 600 million years ago.A new study . 2b, e). Extra data are available from the corresponding author upon request. Following fluorescent in situ hybridization, immunostaining was performed as described above53. Science 304, 13351337 (2004). d Quantification of body length and oral width in control (unfed, n=15 polyps; fed, n=10 polyps) and Fgfrb mutant polyps (unfed, n=15 polyps; fed, n=8 polyps). Pre-bilaterian origins of the Hox cluster and the Hox code: evidence from the sea anemone, Nematostella vectensis. Several alleles were isolated, including two putative null alleles Fgfrbmut1 and Fgfrbmut2, which disrupted the first and second coding exons, respectively (Fig. Google Scholar. 6b, e). Scale bars are 250m. After a 10min incubation, HS was refreshed and samples were incubated at 60C for at least 2h. Hybridization took place for 1620h at 60C in HS containing DIG-labeled RNA probe (0.51.5ngl1). Body width was measured at the base of the tentacles. Yellow dashed line delineates the expression domain of Fgfrb after feeding. b Alternative budding patterns. 5). 6). Post-hybridization washes at 60C were as follows: 10 and 40min in 100% HSW (HSW is HS without salmon testes DNA), 30min each in 75%/25%, 50%/50%, and 25%/75% HSW/2 SSC, 30min in 2 SSC and 3 20min in 0.2 SSC, followed by 10min washes at room temperature in 75%/25%, 50%/50%, and 25%/75% 0.2 SSC/PTW and 100% PTW. Loss of Hox-Gbx activity also elicits marked defects in tentacle patterning along the directive (orthogonal) axis . Nat. The partial sequence by which tentacles are added overtime was also reported, reflecting the existence of continuous axial patterning in polyps. Finnerty, J. R., Pang, K., Burton, P., Paulson, D. & Martindale, M. Q. One day of feeding corresponded to the incubation of polyps with Artemia for ~3h followed by a water change. The RNA in situ probe for Fgfrb was designed to cover ~900 nucleotides. Images were analyzed with ImageJ software54. Note that these discrete ring muscles cells, but not Fgfrb-positive longitudinal tentacle muscles, are missing in the mutant background (controls n=12 polyps and Fgfrb mutants n=6 polyps). 5c, e and Supplementary Fig. d Plots of EdU intensity in control polyps (n=5) and rapamycin-treated polyps (n=5). Polyps with 12-tentacles with one bud (12T+1B, n=10), 13-tentacles (13T, n=16), 13-tentacles with one bud (13T+1B, n=30), 14-tentacles (14T, n=43), 14-tentacles with one bud (14T+1B, n=3), 15-tentacles (15T, n=6), 15-tentacles with one bud (15T+1B, n=20). 217, 137148 (2007). Most of these species (like Spongilla shown above) lack any distinct symmetry and grow as encrusting organisms on hard substrates such as rocks, sticks, etc. Liver fluke has bilateral symmetry, sea anemone has radial symmetry and sea-cucumber has bilateral symmetry in larval form and radial symmetry in adult form. Rev. In both modes, tentacles were generated in pairs, either through simultaneous or consecutive budding events. Samples were then treated with 0.1M TEA (2, 5min), 0.1M TEA/0.3% (v/v) acetic anhydride (5min), 0.1M TEA/0.6% acetic anhydride (5min), PTW (2, 5min) followed by re-fixation in 4% PFA/PTW for 1h. Fixation was stopped by five washes in PTW and 10min in 50% hybridization solution (HS)/PTW before adding HS (50% (v/v) formamide, 1% (w/v) SDS, 5 SSC (pH=4.5), 0.05mgml1 heparin, 0.1mgml1 salmon testes DNA, and 0.1% (v/v) Tween in DEPC-treated water). Class Hexactinellida - Euplectella (Venus' flower basket) a leucon sponge. During the development, four-tentacle buds simultaneously form in the swimming larvae and give rise to the initial appendages of the primary polyp4. Based on knockdown experiments, Fgfra is essential for apical organ formation and metamorphosis. c Dominant budding patterns. c Image of unfed and fed indicated polyps. This slide shows the polyp stage of development of the jellyfish Aurelia called a scyphistoma. that all have the polyp body form. Water enters the sponge through a series of incurrent canals and passes through internal pores called prosopyles into the radial canals, which are lined with flagellated collar cells known as choanocytes. 36, 5760 (1946). Under these conditions, polyps were fed for 3 days and then starved for 4 days until the first pair of buds developed. In the typical cnidarian polyp bauplan, oral tentacles are simple extensions of the diploblastic body, forming appendages that feed, defend, and expand the surface area of the gastric cavity. Guide RNAs (gRNAs) were designed using the online web interface http://chopchop.cbu.uib.no. performed all drug treatment and staining experiments. USA 115, 62316236 (2018). CRISPR/Cas9 genome editing in Nematostella embryos was carried out using an established protocol25. This slide shows a cross section through the body of calcareous marine sponge called Grantia (also called Scypha in some books). 6e and Supplementary Fig. Invertebr. e Quantification of polyps showing PS6RP-postive tentacle primordia in control polyps (n=25) and rapamycin-treated polyps (n=26). Fujiki, A., Hou, S., Nakamoto, A. Aissam Ikmi. Although most of the life of this colonial hydrozoan is spent in the sessile polyp form, medusa buds produced within reproductive polyps called gonangia escape into the water column. This slide shows a cross section through the body of Hydra, a small freshwater cnidarian. 5, 5486 (2014). Class Demospongiae - larger marine sponges, including commercial and bath sponges as well freshwater sponges such as Spongilla that produces gemmules; all leucon type. Most species appear as a single polyp attached to a hard surface such as a rocky or coral reef. Along similar lines, here we uncovered the cellular and signaling mechanisms by which Nematostella polyps integrate the nutritional status of the environment to control postembryonic tentacle development. 12, 34 (2012). g Confocal z-stacks of animals stained with BODIPY (green) and Hoechst (blue; unfed: n=6 polyps and fed/starved n=8 polyps in two independent experiments). 2). Nematostella polyps can harbor a variable number of tentacles ranging from 4 to 18, but the common number in adulthood is 16 (refs. The Fgfrb-eGFP transgenic line was generated by meganuclease-mediated transgenesis26. Google Scholar. Inset box shows four-cell stage embryo divided into two pairs of blastomeres (two independent experiments). Interestingly, these Fgfrb-positive cell clusters were also found during larval development, indicating their potential pre-metamorphic origin (Supplementary Fig. Well show you the way. Gonionemus is a marine hydrozoan jellyfish that swims with its convex aboral surface directed upward and its concave oral surface facing downward. Cnidarian cell type diversity and regulation revealed by whole-organism single-cell RNA-seq. Publishers note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Outside of the animal kingdom, many flowers also exhibit radial symmetry. During sexual reproduction, free-swimming male and female medusae bud off the reproductive polyps, releasing sperm and eggs that fuse to form a ciliated, planula larva that attaches itself to the substrate and begins to form a new colony through asexual budding. PubMed a Confocal z-projections of the oral pole of unfed polyp showing Fgfrb expression (purple) and nuclei (white). Biol. The progeny of these crosses was raised and individually genotyped using genomic DNA extracted from approximately five surgically isolated tentacles. This slide shows a magnified view of a cross section through the body wall of the sea anemone Metridium. This slide shows a magnified view of a cross section through the body wall of the sea anemone Metridium. A close . Bundles of retractor muscles are found within the primary septa. The fixed animals were washed with PBS and stored at 4C until imaged. The British Sea Anemones Vol. Warner, J. F. et al. 5b and Supplementary Fig. of segments s3/s7, mouth (m), and bud (b) areas. Feeding polyps called hydranths bear tentacles armed with nematocysts, a mouth and a thin outer covering or hydrotheca. These results show a continuing requirement for TOR-dependent growth in postembryonic tentacle development. Data are shown as individual data points for each polyp in a Box and Whiskers graph (bottom: 25%; top: 75%; line: median; whiskers: min to max; Unpaired Students two-tailed t-test, ****p<0.0001). To visualize the activity of the TOR pathway, we utilized an antibody directed against a conserved phosphorylation motif in the 40S ribosome protein S6 (pRPS6, Supplementary Fig. Sign up for the Nature Briefing newsletter what matters in science, free to your inbox daily. Leclere, L., Bause, M., Sinigaglia, C., Steger, J. PubMed Central For fluorescent detection, endogenous peroxidases were blocked for 1h in 3% H2O2 and animals washed five times for 5min each in PBT before blocking for 1h at 4C, with blocking buffer and o/n incubation at 4C in 1:1000 DIG-POD (Roche) in blocking buffer. built the spatio-temporal map of tentacle addition. These findings show an unexpected plasticity of tentacle development, and link post-embryonic body patterning with food availability. Most seldom move; some occasionally creep very slowly or move in a slow somersaulting fashion. CAS Curr. Most are from 1 to 5 cm (0.4 to 2.0 in) in diameter and 1.5 to 10 cm (0.6 to 3.9 in) in length, but they are inflatable and vary greatly in dimensions. In sum, this finding reveals that FGF signaling couples the nutrient-dependent organismal growth with postembryonic tentacle development. This slide shows the early strobila stage of the jellyfish Aurelia. PubMed The group is entirely marine, and most species are dull-colored and less than 4 mm long. Internet Explorer). To perform feeding, ~300l of concentrated Artemia was partially homogenized and mixed with 4050 primary polyps in a 6-cm Petri dish. PubMed (3) Leuconoid sponges have the most complex organization, which permits for an increase in body size. View this video animation showing two anemones engaged in a battle. Samples were washed three times in PBS and permeabilized in PBT (PBS with 0.5% Triton X-100; Sigma) for 20min. Wiki User 2011-02-16 03:45:47 This answer is: Study guides Add your. Crowell, S. A new sea anemone for Woods Hole, Massachusetts. Biol. In many cnidarians, these nematocysts contain powerful venoms that can be used for defense or to capture prey. Pukhlyakova, E., Aman, A. J., Elsayad, K. & Technau, U. beta-Catenin-dependent mechanotransduction dates back to the common ancestor of Cnidaria and Bilateria. In these diploblastic organisms, the body wall consists of an outer epidermis and an inner gastrodermis separated by a jelly-like layer of connective tissue called the mesoglea. Yang, C. H. & Andrew Pospisilik, J. Polyphenism - a window into gene-environment interactions and phenotypic plasticity. 3a, b). To determine the role of FGFR signaling, we first treated fed polyps with the FGFR signaling inhibitor SU5402 (Supplementary Fig. Ikmi, A., Steenbergen, P.J., Anzo, M. et al. Inset box shows a four-cell stage embryo. Evodevo 8, 14 (2017). Fgfrbmut1/Fgfrbmut2 animals exhibited a significantly reduced length of both body column and tentacles compared to sibling controls (Fig. Open Access funding provided by Projekt DEAL. Data are meanSD for error bars (unpaired Students two-tailed t-test, ****p<0.0001). This slide shows a magnified view of a cross section through the pharynx of the sea anemone Metridium. Both patterns of growth correlate with the phosphorylation of RPS6, which is highly enriched in developing tentacles compared to the rest of the body. The simple mode of epithelial folding observed in cnidarians has . Pharynx A typical sea anemone is a sessile polyp attached at the base to the surface beneath it by an adhesive foot, called a basal or pedal disc, with a column-shaped body topped by an oral disc. Sci. CAS Lower panels: diagrammatic cross-section through the oral pole summarizes the arrangement of tentacles. Smithsonian Ocean Portal. Source data are provided with this paper. Scholars. Public servants. PLoS ONE 6, e22725 (2011). These results also reveal that Nematostella FGF receptors have distinct functions during development, suggesting the subfunctionalization of paralogs, with Fgfra having a dominant role during embryonic development. Based on these observations and as previously reported during Hox-dependent embryonic segmentation20, the formation of endodermal territories is a common theme in tentacle patterning. Phylum Porifera - Class Hexactinellida. BMC Genomics 17, 718 (2016). Based on the spatio-temporal deployment of new tentacles, we conclude that the nutrient-dependent development of tentacles falls into three phases mediated by six pairs of budding events (Fig. White arrows show tentacles. A straight line tool was used for both measurements. The sequence targets were: first coding exon: GGTGCACGCCGTTTCACTGGTGG and second coding exon: CCAATGTTTCGTGGCGCGCCCGC. 10). The position of primary mesenteries served as a landmark to orient polyps progressing from 4 to 12 tentacles. Figure 2. White asterisks indicate ring muscles expressing Fgfrb. Two primary mesenteries (red arrowheads) form a mirror image along the directive axis. Interestingly, discrete ring muscle cells expressing Fgfrb pre-mark the sites of postembryonic primordia and nucleate the early morphogenetic events associated with the feeding-dependent tentacle development. CAS In addition, Fgfrb mutants also displayed reduced septal filaments and defects in longitudinal tentacle muscle compared to their siblings (Supplementary Fig. They are predatory animals, using batteries of nematocysts on their tentacles to sting and capture prey. The Nematostella genome contains two FGF receptors (a and b) and 15 putative FGF ligands39,41. We used 2l of genomic DNA extract for subsequent PCR analysis. Youre part of a group of truly amazing people. The function of the Nematostella FGF signaling pathway has only been investigated during embryonic and larval development41. Selected polyps were relaxed in 7% MgCl2 (Sigma-Aldrich) and fixed in 4% paraformaldehyde (PFA; Electron Microscopy Sciences) for 90min at room temperature. 7). These fish are dependent upon the anemone for shelter. Here in La Crosse, people come together to work for the common good. 10). Tentacle progression is indicated on the top of each graph and the numbers of analyzed polyps are indicated. 6f). Samples were then washed twice in PBS for 5min followed by 30s in 60% isopropanol. Lack of bud formation was also observed when polyps were only treated with rapamycin from day 3, during the expected period of tentacle budding (Supplementary Fig. Sci. Class Calcarea contains sponges with calcium carbonate spicules of three or four rays. Two long tentacles contain structures called colloblasts that secrete a sticky substance for capturing prey. raised founders and heterozygous mutant animals to sexual maturity. White dashed line separates the two body layers. Nutrient stress arrests tentacle growth in the coral model Aiptasia. 6). Each colored line represents quantification in a single animal (unfed polyps n=5, fed polyps n=5, and fed/started polyps n=6, a.u. In this type of symmetry, identical parts are arranged in a circular fashion around a central axis. Martinez, D. E. & Bridge, D. Hydra, the everlasting embryo, confronts aging. Cell 173, 15201534.e20 (2018). EdU and Hoechst signals were quantified by the total intensity in a selected area of the oral pole spanning s3/s7 segments. 11). 310, 264279 (2007). Fed/starved means animals were fed for 3 days than starved for 4 days. UWL consistently delivers a high-quality and life-changing experience. This manuscript will explore current molecular mechanisms of regeneration employed by non-model . e Confocal z-projections of oral poles of indicated polyps stained with -eGFP (green) and phalloidin (red). d, e Confocal projections of animals stained for EdU incorporation (green) and with Hoechst (blue) in two independent experiments. PLoS ONE 2, e153 (2007). Nature Communications (Nat Commun) F2 Fgfrb-eGFP homozygotes were established and crossed to Fgfrb heterozygous animals to combine the mutant alleles with the Fgfrb reporter construct. Article All three body plans are seen in calcarean sponges. Class Anthozoa - Sea anemones (e.g., Metridium) and hard corals - Soft and horny corals (e.g., sea fans, sea whips, sea pens, etc.) The medusa body type (seen in a typical jellyfish) consists of a free-swimming, bell-shaped form with the aboral end directed upward and the oral end directed downward. Scale bars are 500m in all micrographs. Main text Earthworms or millipedes have fascinated generations of children by their weird, annulated looks that seem so different from us.